Order Kazusa clone(s) from : ![]() |
Product ID | ORK00554 |
---|---|
Accession No | AB011104 |
Description | vacuolar protein sorting 13 homolog B (yeast) |
Clone name | hg03377 |
Vector information | |
cDNA sequence | DNA sequence (6827 bp) Predicted protein sequence (1637 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0532
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1913 bp |
---|---|
Genome contig ID | gi51511724f_100748208 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (210777 - 210826) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 100848208 | 100958983 | 23 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR006025 | 904 | 913 | PS00142 | Peptidase M |
![]() |
---|
Primer_f | TCTATGGGTGGTCAGTAATTC |
---|---|
Primer_r | CAACCTCAGAGTAACTATTTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCTATGGGTGGTCAGTAATTC |
Primer_r | CAACCTCAGAGTAACTATTTC |
PCR product length | 138 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |