Order Kazusa clone(s) from : ![]() |
Product ID | ORK07367 |
---|---|
Accession No | AB002342 |
Description | WNK lysine deficient protein kinase 1 |
Clone name | hg01568 |
Vector information | |
cDNA sequence | DNA sequence (6812 bp) Predicted protein sequence (2066 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0344
by Kazusa Mouse cDNA Project
|
Note | We replaced hg01486, former representative clones for KIAA0344 with hg01568. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 609 bp |
---|---|
Genome contig ID | gi89161190f_633195 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (255635 - 255684) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 733195 | 888828 | 26 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 159 | 411 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 153 | 411 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 153 | 411 | SM00219 | Tyrosine protein kinase |
IPR002290 | 153 | 411 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 153 | 411 | PS50011 | Protein kinase |
ScanRegExp | IPR008271 | 277 | 289 | PS00108 | Serine/threonine protein kinase |
![]() |
---|
Primer_f | ACCATATCCACTCTCTGTCAC |
---|---|
Primer_r | TGTTTCACGCAGTCCATTTTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCATATCCACTCTCTGTCAC |
Primer_r | TGTTTCACGCAGTCCATTTTC |
PCR product length | 206 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |