Order Kazusa clone(s) from : ![]() |
Product ID | ORK05414 |
---|---|
Accession No | AB014598 |
Description | hephaestin, transcript variant 2 |
Clone name | hg00360s1 |
Vector information | |
cDNA sequence | DNA sequence (4228 bp) Predicted protein sequence (1104 aa) |
HaloTag ORF Clone |
FHC05414
![]() |
Flexi ORF Clone | FXC05414 |
Source | Human adult brain |
Rouge ID |
mKIAA0698
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00360, former representative clones for KIAA0698 with hg00360s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 714 bp |
---|---|
Genome contig ID | gi89161218f_65200834 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (203121 - 203170) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001117 | 176 | 313 | PF00394 | Multicopper oxidase |
IPR011707 | 401 | 428 | PF07732 | Multicopper oxidase | |
IPR011706 | 896 | 1012 | PF07731 | Multicopper oxidase | |
ScanRegExp | IPR002355 | 287 | 307 | PS00079 | Multicopper oxidase |
IPR002355 | 639 | 659 | PS00079 | Multicopper oxidase | |
IPR002355 | 986 | 1006 | PS00079 | Multicopper oxidase | |
IPR002355 | 991 | 1002 | PS00080 | Multicopper oxidase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1054 | LASVLVAISVTLLLVVLALGGVV | 1076 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | CTCAACATTCCTTTCAGTGCC |
---|---|
Primer_r | TGAAGGTAGGCTGAGTATTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCAACATTCCTTTCAGTGCC |
Primer_r | TGAAGGTAGGCTGAGTATTGG |
PCR product length | 183 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |