|
Order Kazusa clone(s) from : |
| Product ID | ORK00540 |
|---|---|
| Accession No | AB007917 |
| Description | heparan sulfate 2-O-sulfotransferase 1, transcript variant 1 |
| Clone name | hg00135 |
| Vector information | |
| cDNA sequence | DNA sequence (6632 bp) Predicted protein sequence (362 aa) |
|
HaloTag ORF Clone |
FHC00540
|
| Flexi ORF Clone | FXC00540 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0448
by Kazusa Mouse cDNA Project
|
Length: 6632 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 5279 bp |
|---|---|
| Genome contig ID | gi89161185f_87053026 |
| PolyA signal sequence (TATAAA,-7) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (295228 - 295277) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | f | 87153026 | 87348252 | 7 | 99.2 | Perfect prediction |
Length: 362 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR007734 | 15 | 360 | PF05040 | Heparan sulphate 2-O-sulphotransferase |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 16 | PKLQLLAVVAFAVAMLFLENQIQ | 38 | PRIMARY | 23 |
|---|
Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C sec °C sec cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TACATCATGCCCAACCTTTAC |
| Primer_r | CATTTATGGCACAGTTTGGAC |
| PCR product length | 340 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |