KIAA0514

Product ID	ORK05349
Accession No	AB011086
Description	G protein-regulated inducer of neurite outgrowth 2 (GRIN2).
Clone name	hf00310
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7724 bp) Predicted protein sequence (483 aa)
Source	Human adult brain

Length: 7724 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	5387 bp
Genome contig ID	gi89161187f_46317932
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCAGAAGAACACCTGAGGAAAGCTGATGTTTACT
Flanking genome sequence (107719 - 107768)	----+--------+--------+--------+--------+----* AAAAAAAAAAACAAGCGAAACCAAAGTGACGTGGGCCCATAGGATTGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	46417932	46425649	1	98.0	Perfect prediction

Length: 483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH11672	4.6e-163	100.0	GPRIN2 protein ...	Homo sapiens
O60269	2.1e-157	97.6	G protein-regul...	Homo sapiens
XP_001082938	2.3e-153	95.2	hypothetical pr...	Macaca mulatta
XP_001500796	1.5e-124	79.4	similar to GPRI...	Equus caballus
XP_592057	3.8e-117	76.8	similar to G pr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CTTTATTATTCCCGTGTAGCC
Primer_r	CTTCTTTAGGCTTGCTCACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 10

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTTTATTATTCCCGTGTAGCC
Primer_r	CTTCTTTAGGCTTGCTCACTC
PCR product length	117 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles