| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00460 | 
|---|---|
| Accession No | D86966 | 
| Description | zinc finger protein 592 | 
| Clone name | ha02768 | 
| Vector information | |
| cDNA sequence | DNA sequence (5086 bp) Predicted protein sequence (1317 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00460
     
     
     | 
| Flexi ORF Clone | FXC00460 | 
| Source | Myeloblast cell line (KG-1) | 
| Rouge ID | 
    mKIAA0211
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 5086 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 712 bp | 
|---|---|
| Genome contig ID | gi51511731f_82992584 | 
| PolyA signal sequence (AATAAA,-19)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (154948 - 154997)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 15 | f | 83092584 | 83147530 | 12 | 99.6 | Perfect prediction | 
 
        Length: 1317 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR007087 | 942 | 965 | PF00096 | Zinc finger | 
| IPR007087 | 1063 | 1086 | PF00096 | Zinc finger | |
| IPR007087 | 1203 | 1226 | PF00096 | Zinc finger | |
| HMMSmart | IPR015880 | 637 | 662 | SM00355 | Zinc finger | 
| IPR015880 | 665 | 689 | SM00355 | Zinc finger | |
| IPR015880 | 761 | 781 | SM00355 | Zinc finger | |
| IPR015880 | 790 | 812 | SM00355 | Zinc finger | |
| IPR015880 | 818 | 842 | SM00355 | Zinc finger | |
| IPR015880 | 849 | 872 | SM00355 | Zinc finger | |
| IPR015880 | 877 | 900 | SM00355 | Zinc finger | |
| IPR015880 | 942 | 965 | SM00355 | Zinc finger | |
| IPR015880 | 1033 | 1056 | SM00355 | Zinc finger | |
| IPR015880 | 1063 | 1086 | SM00355 | Zinc finger | |
| IPR015880 | 1093 | 1119 | SM00355 | Zinc finger | |
| IPR015880 | 1174 | 1196 | SM00355 | Zinc finger | |
| IPR015880 | 1203 | 1226 | SM00355 | Zinc finger | |
| ProfileScan | IPR007087 | 637 | 662 | PS50157 | Zinc finger | 
| IPR007087 | 790 | 817 | PS50157 | Zinc finger | |
| IPR007087 | 942 | 970 | PS50157 | Zinc finger | |
| IPR007087 | 1063 | 1091 | PS50157 | Zinc finger | |
| ScanRegExp | IPR007087 | 792 | 814 | PS00028 | Zinc finger | 
| IPR007087 | 879 | 900 | PS00028 | Zinc finger | |
| IPR007087 | 944 | 965 | PS00028 | Zinc finger | |
| IPR007087 | 1035 | 1056 | PS00028 | Zinc finger | |
| IPR007087 | 1065 | 1086 | PS00028 | Zinc finger | |
| IPR007087 | 1205 | 1226 | PS00028 | Zinc finger | 
 Chromosome No. 18
 Experimental conditions| Panel name | Genebridge 4 | 
|---|---|
| Primer_f | AGCTCTGCCTAGTCTGGTTTG | 
| Primer_r | CAAATGGCACGAGAGCAGTAC | 
| PCR product length | 142 bp | 
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |