Order Kazusa clone(s) from : ![]() |
Product ID | ORK00387 |
---|---|
Accession No | D29642 |
Description | Rho GTPase activating protein 25, transcript variant 2 |
Clone name | ha01417 |
Vector information | |
cDNA sequence | DNA sequence (2739 bp) Predicted protein sequence (666 aa) |
Flexi ORF Clone | FXC00387 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0053
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 629 bp |
---|---|
Genome contig ID | gi89161199f_68755624 |
PolyA signal sequence (AATAAA,-15) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (151837 - 151886) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 68855624 | 68907459 | 10 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001849 | 68 | 172 | PF00169 | Pleckstrin-like |
IPR000198 | 198 | 351 | PF00620 | RhoGAP | |
HMMSmart | IPR001849 | 68 | 174 | SM00233 | Pleckstrin-like |
IPR000198 | 195 | 371 | SM00324 | RhoGAP | |
ProfileScan | IPR001849 | 67 | 172 | PS50003 | Pleckstrin-like |
IPR000198 | 180 | 374 | PS50238 | RhoGAP |
Panel name | Stanford G3 |
---|---|
Primer_f | GCCCCTTTCTCAGTGCTATCT |
Primer_r | TCTCTGCTCACCCTCACCTTC |
PCR product length | 134 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |