KIAA0061

Product ID	ORK06434
Accession No	D31765
Description	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Clone name	ha01242
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4276 bp) Predicted protein sequence (903 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0061 by Kazusa Mouse cDNA Project

Length: 4276 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1562 bp
Genome contig ID	gi51511724f_99109820
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GCATCTGTAAACAGAATAAATGAAAATGTCACCTG
Flanking genome sequence (131420 - 131469)	----+--------+--------+--------+--------+----* ATGTTCAGTTGTGAATATTTATATTTATTGGACCATTCCTTATTTGTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	99209820	99241238	13	99.5	Perfect prediction

Length: 903 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q99575	100.0	Ribonucleases P...	Homo sapiens
AAH11529	99.8	Processing of p...	Homo sapiens
XP_001149384	99.1	processing of p...	Pan troglodytes
XP_001915387	83.9	similar to Ribo...	Equus caballus
XP_878948	80.5	similar to Ribo...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009723	1	137	PF06978	Ribonuclease P/MRP
HMMPfam	IPR012590	496	587	PF08170	POPLD

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	CTTTCCCTGTCCTTGCTGTAA
Primer_r	GTCTTCTCTTGTCTTCTGCTA
PCR product length	235 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles