ROUGE

Gene/Protein Characteristic Table for mKIAA0061

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172880
Description :	processing of precursors 1 homolog isoform 2. ribonucleases P/MRP protein subunit homolog. processing of precursors 1.
Clone Name :	mej00104 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2831 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 141 bp

Genome contig ID gi65543215f_34427528
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
CGTGGAAACAAGAATTAAAATTATGTAATCATGTG
Flanking genome sequence
(102832 - 102881)
----+----*----+----*----+----*----+----*----+----*
GATGATGATTTGTTTTTAATCTGACTCTTTTCCATCTTTTCCTGTCCTGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0061 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0061	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1965..2690
Length: 241 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL08847	1.9e-90	99.1	processing of p...	Mus musculus
BAB30296	1.9e-90	99.1	unnamed protein...	Mus musculus
AAH34742	1.9e-90	99.1	Processing of p...	Mus musculus
EDL08848	1.9e-90	99.1	processing of p...	Mus musculus
EDM16418	6.8e-80	89.0	processing of p...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	141 bp
Genome contig ID	gi65543215f_34427528
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- CGTGGAAACAAGAATTAAAATTATGTAATCATGTG
Flanking genome sequence (102832 - 102881)	----+--------+--------+--------+--------+----* GATGATGATTTGTTTTTAATCTGACTCTTTTCCATCTTTTCCTGTCCTGG

Gene/Protein Characteristic Table for mKIAA0061

Features of the cloned DNA sequence

Features of the protein sequence