Order Kazusa clone(s) from : ![]() |
Product ID | ORK00877 |
---|---|
Accession No | AB046832 |
Description | 2-oxoglutarate and iron-dependent oxygenase domain containing 1 |
Clone name | fj12771 |
Vector information | |
cDNA sequence | DNA sequence (4550 bp) Predicted protein sequence (550 aa) |
HaloTag ORF Clone |
FHC00877
![]() |
Flexi ORF Clone | FXC00877 |
Source | Human fetal brain |
Rouge ID |
mKIAA1612
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2897 bp |
---|---|
Genome contig ID | gi51511732f_54943002 |
PolyA signal sequence (GATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (127513 - 127562) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 55043002 | 55070513 | 13 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTACATCATCTACAGCAGCAC |
---|---|
Primer_r | CCTAAGAGTTGTTGACATTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |