KIAA1693

Product ID	ORK06105
Accession No	AB051480
Description	Neuroblastoma breakpoint family member 10.
Clone name	fj10588
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4239 bp) Predicted protein sequence (901 aa)
Source	Human fetal brain

Length: 4239 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1531 bp
Genome contig ID	gi89161185f_143906782
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAAAAGCTTTTGCCTCTAGATCGCGGGCGGCCGC
Flanking genome sequence (1127476 - 1127427)	----+--------+--------+--------+--------+----* AACTTATATTCCAAAGATCTTTTTTATTTTAATTTTTTAAATTTGTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	143326610	143541655	20	96.4	Terminal No-hit
Ensembl gnome browser	1	f	144004887	144081552	21	96.7	Terminal No-hit
Ensembl gnome browser	1	f	147006309	147024822	15	96.5	Terminal No-hit
Ensembl gnome browser	1	f	146844224	146862778	15	96.0	Terminal No-hit
Ensembl gnome browser	1	r	16761513	16784621	18	99.5	Both No-hit

Length: 901 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q3BBV0	97.9	Neuroblastoma b...	Homo sapiens
Q3BBV1	93.7	Neuroblastoma b...	Homo sapiens
CAM23768	92.7	neuroblastoma b...	Homo sapiens
AAH86308	95.0	NBPF8 protein [...	Homo sapiens
Q3BBV2	94.5	Neuroblastoma b...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033071	3.5e-115	94.1	KIAA1245
AB007923	2.4e-05	28.7	KIAA0454

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010630	138	201	PF06758	Protein of unknown function DUF1220
	IPR010630	409	471	PF06758	Protein of unknown function DUF1220
	IPR010630	495	558	PF06758	Protein of unknown function DUF1220
	IPR010630	567	633	PF06758	Protein of unknown function DUF1220
	IPR010630	642	708	PF06758	Protein of unknown function DUF1220
	IPR010630	717	783	PF06758	Protein of unknown function DUF1220
	IPR010630	812	878	PF06758	Protein of unknown function DUF1220

Primer_f	CATGTCTCTGAGCTTCTATAC
Primer_r	GTGTTACAGATGGATCAGCTA
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-