| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00872 | 
|---|---|
| Accession No | AB046807 | 
| Description | melanoma antigen family E1 | 
| Clone name | fj08327 | 
| Vector information | |
| cDNA sequence | DNA sequence (3628 bp) Predicted protein sequence (991 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00872
     
     
     | 
| Flexi ORF Clone | FXC00872 | 
| Source | Human fetal brain | 
| Rouge ID | 
    mKIAA1587
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 3628 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 547 bp | 
|---|---|
| Genome contig ID | gi89161218f_75464521 | 
| PolyA signal sequence (AATAAA,-20)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (103629 - 103678)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
 
        Length: 991 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| BlastProDom | NULL | 198 | 324 | PD041608 | NULL | 
| IPR008165 | 325 | 423 | PD003992 | Protein of unknown function GLTT | |
| NULL | 424 | 471 | PD041608 | NULL | |
| HMMPfam | IPR002190 | 532 | 702 | PF01454 | MAGE protein | 
| IPR002190 | 786 | 948 | PF01454 | MAGE protein | |
| ProfileScan | IPR002190 | 525 | 724 | PS50838 | MAGE protein | 
| IPR002190 | 779 | 970 | PS50838 | MAGE protein | 
           
	  RT-PCR-ELISA
	   | 
          
	  
 Experimental conditions| Primer_f | GTTTACGGGTTCCTGACAGTG | 
|---|---|
| Primer_r | AACATCAGCTCTATTGGCCTC | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. X
 Experimental conditions| Panel name | unigene | 
|---|---|
| Primer_f | - | 
| Primer_r | - | 
| PCR product length | - | 
| PCR conditions | - |