Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07236 |
---|---|
Accession No | AB058758 |
Description | tau tubulin kinase 1 |
Clone name | fg04654 |
Vector information | |
cDNA sequence | DNA sequence (6697 bp) Predicted protein sequence (1270 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1855
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2883 bp |
---|---|
Genome contig ID | gi89161210f_43228499 |
PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (135478 - 135527) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 43328499 | 43363975 | 13 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 5 | 204 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 1 | 109 | PF00069 | Protein kinase |
IPR000719 | 125 | 189 | PF00069 | Protein kinase | |
HMMSmart | IPR002290 | 1 | 257 | SM00220 | Serine/threonine protein kinase |
IPR001245 | 3 | 242 | SM00219 | Tyrosine protein kinase | |
ProfileScan | IPR000719 | 1 | 246 | PS50011 | Protein kinase |
RT-PCR-ELISA |
Primer_f | TCAAGGACAAGGAACAGGTAG |
---|---|
Primer_r | CTCTCCTTCATGCTGTTCTCA |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCATTTCCCAGCTCCTCACAG |
Primer_r | AACATTCTTAGGTGGCTTCCC |
PCR product length | 95 bp |
PCR conditions | 15 °C64 sec60 °C30 sec130 cycles |