Order Kazusa clone(s) from : ![]() |
Product ID | ORK01067 |
---|---|
Accession No | AB002322 |
Description | serine/arginine repetitive matrix 2 |
Clone name | ee08846s1 |
Vector information | |
cDNA sequence | DNA sequence (9003 bp) Predicted protein sequence (2800 aa) |
Source | |
Rouge ID |
mKIAA0324
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00514, former representative clones for KIAA0324 with ee08846s1. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 543 bp |
---|---|
Genome contig ID | gi51511732f_2642767 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (118647 - 118696) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 2742679 | 2761412 | 15 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | CAACCTCATGGGGGACAGTAG |
---|---|
Primer_r | GTATCCAGAAGTTCCCAGGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAACCTCATGGGGGACAGTAG |
Primer_r | GTATCCAGAAGTTCCCAGGGG |
PCR product length | 122 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |