Order Kazusa clone(s) from : ![]() |
Product ID | ORK04022 |
---|---|
Accession No | AB082527 |
Description | acyl-CoA binding domain containing 5, transcript variant 3 |
Clone name | bj00079 |
Vector information | |
cDNA sequence | DNA sequence (3682 bp) Predicted protein sequence (437 aa) |
HaloTag ORF Clone |
FHC04022
![]() |
Flexi ORF Clone | FXC04022 |
Source | Human adult brain |
Rouge ID |
mKIAA1996
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2210 bp |
---|---|
Genome contig ID | gi89161187r_27424155 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 27524155 | 27571023 | 12 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000582 | 6 | 37 | PD351532 | Acyl-coA-binding protein |
HMMPfam | IPR000582 | 13 | 43 | PF00887 | Acyl-coA-binding protein |
ProfileScan | IPR000582 | 1 | 44 | PS51228 | Acyl-coA-binding protein |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 405 | EMSPGVLTFAIIWPFIAQWLVYL | 427 | PRIMARY | 23 |
---|
![]() |
Primer_f | TATCTTAGTCACGGAGTTGCC |
---|---|
Primer_r | ATCAGTGGGTTATGTCTAGCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |