Gene/Protein Characteristic Table for KIAA1992
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07240
Accession No AB082523
Description tetratricopeptide repeat domain 21B
Clone name bg00166
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (6583 bp)
Predicted protein sequence (853 aa)
Source Human adult brain
Rouge ID mKIAA1992 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6583 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 4021 bp
Genome contig ID gi89161199r_166322234
PolyA signal sequence
(AATATA,-28)		 
+----*----+----*----+----*----+----
TTTTAAAAATATAATACAACTGAGAAGTCTTCATT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAATTGTTCTGGTGGTCCTACCTGTTTTCTGTTAGGGATCCAATACATCT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 2 r 166422234 166489431 21 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 853 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_079029 0 100.0 tetratricopepti...
 Homo sapiens
Q7Z4L5 0 100.0 Tetratricopepti...
 Homo sapiens
BAF85631 0 99.8 unnamed protein...
 Homo sapiens
XP_001096248 0 98.2 similar to tetr...
 Macaca mulatta
AAI51354 0 91.8 TTC21B protein ...
 Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001440 29 62 PF00515 Tetratricopeptide TPR_1
IPR001440 259 292 PF00515 Tetratricopeptide TPR_1
IPR001440 293 326 PF00515 Tetratricopeptide TPR_1
IPR001440 368 401 PF00515 Tetratricopeptide TPR_1
IPR013105 421 454 PF07719 Tetratricopeptide TPR_2
IPR013105 489 522 PF07719 Tetratricopeptide TPR_2
IPR001440 734 767 PF00515 Tetratricopeptide TPR_1
IPR001440 803 836 PF00515 Tetratricopeptide TPR_1
HMMSmart IPR013026 29 62 SM00028 Tetratricopeptide region
IPR013026 63 96 SM00028 Tetratricopeptide region
IPR013026 100 133 SM00028 Tetratricopeptide region
IPR013026 191 224 SM00028 Tetratricopeptide region
IPR013026 259 292 SM00028 Tetratricopeptide region
IPR013026 293 326 SM00028 Tetratricopeptide region
IPR013026 327 359 SM00028 Tetratricopeptide region
IPR013026 368 401 SM00028 Tetratricopeptide region
IPR013026 421 454 SM00028 Tetratricopeptide region
IPR013026 455 488 SM00028 Tetratricopeptide region
IPR013026 489 522 SM00028 Tetratricopeptide region
IPR013026 560 592 SM00028 Tetratricopeptide region
IPR013026 694 727 SM00028 Tetratricopeptide region
IPR013026 734 767 SM00028 Tetratricopeptide region
IPR013026 803 836 SM00028 Tetratricopeptide region
ProfileScan IPR013026 29 62 PS50005 Tetratricopeptide region
IPR013026 29 96 PS50293 Tetratricopeptide region
IPR013026 191 556 PS50293 Tetratricopeptide region
IPR013026 259 292 PS50005 Tetratricopeptide region
IPR013026 293 326 PS50005 Tetratricopeptide region
IPR013026 368 401 PS50005 Tetratricopeptide region
IPR013026 421 454 PS50005 Tetratricopeptide region
IPR013026 489 522 PS50005 Tetratricopeptide region
IPR013026 659 836 PS50293 Tetratricopeptide region
IPR013026 734 767 PS50005 Tetratricopeptide region
IPR013026 803 836 PS50005 Tetratricopeptide region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GAGTTTGAGAAGAGTTGGCTG
Primer_r CATCTCATAGTTCAAGGCAGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp