FLJ00084

Gene/Protein Characteristic Table for FLJ00084

Order Kazusa clone(s) from :

Product ID	ORK06221
Accession No	AK024485
Clone name	as00084
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4505 bp) Predicted protein sequence (641 aa)
Source	Human spleen
Rouge ID	mFLJ00084 by Kazusa Mouse cDNA Project

Length: 4505 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Features of the protein sequence

Description

Length: 641 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15775	2.3e-174	100.0	FLJ00084 protei...	Homo sapiens
CAC28882	1.1e-169	99.7	opioid growth f...	Homo sapiens
AAH32666	2.1e-161	98.8	OGFR protein [H...	Homo sapiens
EAW75339	4.4e-161	98.5	opioid growth f...	Homo sapiens
Q9NZT2	4.5e-161	98.5	Opioid growth f...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006757	45	259	PF04664	Opioid growth factor receptor (OGFr) conserved region
	IPR006770	481	500	PF04680	Opioid growth factor receptor repeat
	IPR006770	501	520	PF04680	Opioid growth factor receptor repeat
	IPR006770	521	540	PF04680	Opioid growth factor receptor repeat
	IPR006770	541	560	PF04680	Opioid growth factor receptor repeat
	IPR006770	561	580	PF04680	Opioid growth factor receptor repeat
	IPR006770	581	600	PF04680	Opioid growth factor receptor repeat
	IPR006770	601	620	PF04680	Opioid growth factor receptor repeat
ProfileScan	IPR000694	474	618	PS50099	Proline-rich region

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTTGTGTCTGATGGATCCCTG
Primer_r	CTGGATGTAGGAGTGATTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp