ROUGE

Gene/Protein Characteristic Table for mFLJ00084

Link to : NEDO \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC049965
Description :	Opioid growth factor receptor.
Clone Name :	mpj01745 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1543 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 305 bp

Genome contig ID gi66880554f_180211247
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGAGGCCTTTTCTGAATAAACTCTTTAGGCTTTGT
Flanking genome sequence
(101544 - 101593)
----+----*----+----*----+----*----+----*----+----*
CTTTTGGTGTGGCCGTGTTCTGTTTGGTTGCCTGTGACCCTTAGCCTTCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00084 DNA sequence, Physical map

KIAA	Alignment based on:
FLJ00084	DNA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1235
Length: 411 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH49965	2.4e-133	100.0	Opioid growth f...	Mus musculus
Q99PG2	2.4e-133	100.0	Opioid growth f...	Mus musculus
EDL07343	3.6e-118	97.8	opioid growth f...	Mus musculus
AAH03875	3.2e-107	90.8	Ogfr protein [M...	Mus musculus
BAE28751	1.4e-94	82.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 231 366 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	231	366	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	305 bp
Genome contig ID	gi66880554f_180211247
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAGGCCTTTTCTGAATAAACTCTTTAGGCTTTGT
Flanking genome sequence (101544 - 101593)	----+--------+--------+--------+--------+----* CTTTTGGTGTGGCCGTGTTCTGTTTGGTTGCCTGTGACCCTTAGCCTTCT

Gene/Protein Characteristic Table for mFLJ00084

Features of the cloned DNA sequence

Features of the protein sequence