ROUGE |
Gene/Protein Characteristic Table for mFLJ00084 |
Link to : NEDO | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC049965 |
---|---|
Opioid growth factor receptor. | |
mpj01745 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1543 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 305 bp Genome contig ID gi66880554f_180211247 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TGAGGCCTTTTCTGAATAAACTCTTTAGGCTTTGTFlanking genome sequence
(101544 - 101593) ----+----*----+----*----+----*----+----*----+----*
CTTTTGGTGTGGCCGTGTTCTGTTTGGTTGCCTGTGACCCTTAGCCTTCT
KIAA Alignment based on: FLJ00084 DNA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1235
Length: 411 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |