FLJ00065

Product ID	ORK04275
Accession No	AK024472
Clone name	as00065
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4545 bp) Predicted protein sequence (204 aa)
Source	Human spleen
Rouge ID	mFLJ00065 by Kazusa Mouse cDNA Project

Length: 4545 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Length: 204 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15762	4.3e-85	100.0	FLJ00065 protei...	Homo sapiens
AAH60783	1.4e-76	100.0	BMF protein [Ho...	Homo sapiens
Q96LC9	8.4e-76	100.0	Bcl-2-modifying...	Homo sapiens
AAH69328	2e-75	99.5	BMF protein [Ho...	Homo sapiens
AAH69505	2.7e-75	99.5	Bcl2 modifying ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

No significant homologues

RT-PCR-ELISA

Experimental conditions

Primer_f	TTGAGTCTTGAGGGGATAGCG
Primer_r	CCCTGGGGATGAACAAAATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles