ROUGE

Gene/Protein Characteristic Table for mFLJ00065

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK040622
Description :	Bcl2 modifying factor.
Clone Name :	mfj02167 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4554 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3794 bp

Genome contig ID gi66880554r_117942610
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CAAGTGGTACAGTTTTTAATAAAACCATTTAAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATCTGTTCTTTATTTTTTCTAAGGTGTGTTAAAAGTACAAGAGGGAGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00065 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00065	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..760
Length: 252 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC39243	3.6e-108	100.0	unnamed protein...	Mus musculus
EDL79865	1.1e-100	93.3	Bcl2 modifying ...	Rattus norvegicus
AAH60783	5.1e-79	84.4	BMF protein [Ho...	Homo sapiens
CAM19075	8.4e-79	100.0	Bcl2 modifying ...	Mus musculus
Q91ZE9	2.9e-77	100.0	Bcl-2-modifying...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3794 bp
Genome contig ID	gi66880554r_117942610
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CAAGTGGTACAGTTTTTAATAAAACCATTTAAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATCTGTTCTTTATTTTTTCTAAGGTGTGTTAAAAGTACAAGAGGGAGC

Gene/Protein Characteristic Table for mFLJ00065

Features of the cloned DNA sequence

Features of the protein sequence