|
Order Kazusa clone(s) from : |
| Product ID | ORK05492 |
|---|---|
| Accession No | AK024435 |
| Clone name | as00025 |
| Vector information | |
| cDNA sequence | DNA sequence (4559 bp) Predicted protein sequence (955 aa) |
| Source | Human spleen |
| Rouge ID |
mFLJ00025
by Kazusa Mouse cDNA Project
|
Length: 4559 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | Warning |
Length: 955 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR001680 | 43 | 74 | PD000018 | G-protein beta WD-40 repeat |
| HMMPfam | IPR001680 | 38 | 75 | PF00400 | G-protein beta WD-40 repeat |
| IPR001680 | 77 | 114 | PF00400 | G-protein beta WD-40 repeat | |
| IPR001680 | 118 | 154 | PF00400 | G-protein beta WD-40 repeat | |
| IPR001680 | 161 | 202 | PF00400 | G-protein beta WD-40 repeat | |
| IPR001680 | 247 | 284 | PF00400 | G-protein beta WD-40 repeat | |
| IPR001680 | 440 | 477 | PF00400 | G-protein beta WD-40 repeat | |
| HMMSmart | IPR001680 | 36 | 75 | SM00320 | G-protein beta WD-40 repeat |
| IPR001680 | 77 | 114 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 116 | 154 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 156 | 202 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 204 | 243 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 245 | 284 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 442 | 477 | SM00320 | G-protein beta WD-40 repeat | |
| ProfileScan | IPR001680 | 43 | 74 | PS50082 | G-protein beta WD-40 repeat |
| IPR001680 | 43 | 84 | PS50294 | G-protein beta WD-40 repeat |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CAGAGAACGATCGCTTTGAGG |
|---|---|
| Primer_r | CTATATCGAGGCACTGCATGG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |