KIAA1760

Product ID	ORK02051
Accession No	AB051547
Description	WNK lysine deficient protein kinase 2
Clone name	af00030
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7792 bp) Predicted protein sequence (2219 aa)
HaloTag ORF Clone	FHC02051
Flexi ORF Clone	FXC02051
Source	Human brain (amygdala)
Rouge ID	mKIAA1760 by Kazusa Mouse cDNA Project
Note	We replaced fh22167, former representative clones for KIAA1760 with af00030. (2003/4/2)

Length: 7792 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1130 bp
Genome contig ID	gi89161216f_94887142
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TATATCTGAAGGAGAAAAATAAACACTTTTGCTCG
Flanking genome sequence (234167 - 234216)	----+--------+--------+--------+--------+----* AAAACAGTGTGAAACAACATCTTTTTCTTACCCTCTATCCATATAAAATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	94987046	95121307	29	99.6	Perfect prediction

Length: 2219 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72864	100.0	WNK lysine defi...	synthetic construct
NP_006639	100.0	WNK lysine defi...	Homo sapiens
EAW62860	99.0	WNK lysine defi...	Homo sapiens
EAW62859	99.0	WNK lysine defi...	Homo sapiens
EAW62858	99.0	WNK lysine defi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002342	5.5e-35	34.0	KIAA0344
AB046786	7.9e-06	25.4	KIAA1566
AB007927	4.2e-05	25.0	KIAA0458
AB040904	0.0001	29.2	KIAA1471
AB002307	0.00014	23.5	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	196	448	PD000001	Protein kinase
HMMPfam	IPR000719	190	448	PF00069	Protein kinase
HMMSmart	IPR001245	190	448	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	190	448	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	190	448	PS50011	Protein kinase
ScanRegExp	IPR008271	314	326	PS00108	Serine/threonine protein kinase

Primer_f	GTTAGAACCTTGTCGTCACCC
Primer_r	AACCATTCACATCTCTGCAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-