KIAA1471

Product ID	ORK06531
Accession No	AB040904
Description	protein tyrosine phosphatase, non-receptor type 23
Clone name	fj02383s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-279) was subcloned upstream of the cDNA (280-4265). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGG CCGCACTAGT GATT-5' end of cDNA.
cDNA sequence	DNA sequence (4265 bp) Predicted protein sequence (1421 aa)
Source	Human fetal brain
Rouge ID	mKIAA1471 by Kazusa Mouse cDNA Project
Note	We replaced fj02383, former representative clones for KIAA1471 with fj02383s1. (2002/5/10)

Length: 4265 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi89161205f_47297476
PolyA signal sequence (None)	+--------+--------+----*----+---- GGAGGTGCACGCACATTACCTGCATCAGCGGCCGC
Flanking genome sequence (131190 - 131239)	----+--------+--------+--------+--------+----* TGCACACGCCCATCATTGTGCACTGCAGGTAGAGGGTGGGCCTGAGGGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	47397476	47428664	22	99.6	Perfect prediction

Length: 1421 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H3S7	99.9	Tyrosine-protei...	Homo sapiens
EAW64822	99.7	protein tyrosin...	Homo sapiens
XP_001100428	97.1	similar to prot...	Macaca mulatta
XP_001495556	93.2	protein tyrosin...	Equus caballus
BAG61747	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067516	0.0001	33.2	KIAA1929
AB051547	0.00014	29.2	KIAA1760
AB007927	0.00038	25.7	KIAA0458
AB051468	0.00068	25.9	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000242	1280	1287	PR00700	Protein-tyrosine phosphatase
	IPR000242	1297	1317	PR00700	Protein-tyrosine phosphatase
	IPR000242	1383	1400	PR00700	Protein-tyrosine phosphatase
HMMPfam	IPR004328	46	422	PF03097	BRO1
HMMPfam	IPR000242	1255	1418	PF00102	Protein-tyrosine phosphatase
HMMSmart	IPR000242	1228	1421	SM00194	Protein-tyrosine phosphatase
ProfileScan	IPR004328	46	432	PS51180	BRO1
ProfileScan	IPR000242	1258	1421	PS50055	Protein-tyrosine phosphatase

Primer_f	GAGGACATCAAGTACGAGCAG
Primer_r	CTTCATGCCCTCCTCAGACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATGACATCACTGCCTCGCTGG
Primer_r	TACTGCACGTTGGCCTCTGTC
PCR product length	160(250) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles