Order Kazusa clone(s) from : ![]() |
Product ID | ORK06807 |
---|---|
Accession No | AB082533 |
Description | pseudopodium-enriched atypical kinase 1 |
Clone name | bf00111 |
Vector information | |
cDNA sequence | DNA sequence (8282 bp) Predicted protein sequence (764 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA2002
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 5986 bp |
---|---|
Genome contig ID | gi51511731r_75087561 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 75187561 | 75258378 | 4 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 530 | 678 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 363 | 681 | PF00069 | Protein kinase |
HMMSmart | IPR002290 | 362 | 684 | SM00220 | Serine/threonine protein kinase |
ProfileScan | IPR000719 | 331 | 693 | PS50011 | Protein kinase |
ScanRegExp | IPR008266 | 530 | 542 | PS00109 | Tyrosine protein kinase |
![]() |
Primer_f | GGCATGAGGCAAATACAGAAG |
---|---|
Primer_r | GAGAGGACCTTTCAATGATAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |