Order Kazusa clone(s) from : ![]() |
Product ID | ORK05737 |
---|---|
Accession No | AB075855 |
Description | ankyrin repeat and GTPase domain Arf GTPase activating protein 11 |
Clone name | aj01061 |
Vector information | |
cDNA sequence | DNA sequence (4559 bp) Predicted protein sequence (597 aa) |
Source | Human brain (amygdala) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 298 bp |
---|---|
Genome contig ID | gi89161187f_88642143 |
PolyA signal sequence (AATATA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (117799 - 117848) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 88742143 | 88759940 | 7 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001164 | 387 | 406 | PR00405 | Arf GTPase activating protein |
IPR001164 | 406 | 423 | PR00405 | Arf GTPase activating protein | |
IPR001164 | 427 | 448 | PR00405 | Arf GTPase activating protein | |
IPR002110 | 535 | 547 | PR01415 | Ankyrin | |
IPR002110 | 580 | 592 | PR01415 | Ankyrin | |
HMMPfam | IPR001849 | 169 | 354 | PF00169 | Pleckstrin-like |
IPR001164 | 375 | 495 | PF01412 | Arf GTPase activating protein | |
IPR002110 | 534 | 566 | PF00023 | Ankyrin | |
IPR002110 | 567 | 592 | PF00023 | Ankyrin | |
HMMSmart | IPR001849 | 169 | 356 | SM00233 | Pleckstrin-like |
IPR001164 | 375 | 495 | SM00105 | Arf GTPase activating protein | |
IPR002110 | 534 | 563 | SM00248 | Ankyrin | |
IPR002110 | 567 | 596 | SM00248 | Ankyrin | |
ProfileScan | IPR001849 | 168 | 354 | PS50003 | Pleckstrin-like |
IPR001164 | 375 | 495 | PS50115 | Arf GTPase activating protein | |
IPR002110 | 502 | 591 | PS50297 | Ankyrin | |
IPR002110 | 534 | 566 | PS50088 | Ankyrin |
![]() |
Primer_f | GCAGAGCCATCCCCATTAAAC |
---|---|
Primer_r | TTCCTGGGACTTTGATGGTAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |