KIAA1945

Product ID	ORK04049
Accession No	AB075825
Description	antizyme inhibitor 2
Clone name	fh14407
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5848 bp) Predicted protein sequence (420 aa)
Source	Human fetal brain
Rouge ID	mKIAA1945 by Kazusa Mouse cDNA Project

Length: 5848 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2410 bp
Genome contig ID	gi89161185f_33219959
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GCAAATAAATAAATATTTAGGTTTTTAAAAACTGC
Flanking genome sequence (138761 - 138810)	----+--------+--------+--------+--------+----* AGCGGAATCTGGCAGTTTGATTCACAAAGCAGCCTGGGCTAGGCCTGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	33319847	33358718	7	99.6	Perfect prediction

Length: 420 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX07477	6.2e-176	100.0	arginine decarb...	Homo sapiens
EAX07470	6.8e-176	100.0	arginine decarb...	Homo sapiens
Q96A70	3.3e-170	100.0	Arginine decarb...	Homo sapiens
EAX07471	3.7e-170	100.0	arginine decarb...	Homo sapiens
AAQ62560	1.6e-169	99.7	arginine decarb...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002433	44	68	PR01182	Ornithine decarboxylase
	IPR002433	70	97	PR01182	Ornithine decarboxylase
	IPR000183	72	90	PR01179	Orn/DAP/Arg decarboxylase 2
	IPR000183	92	104	PR01179	Orn/DAP/Arg decarboxylase 2
	IPR002433	114	138	PR01182	Ornithine decarboxylase
	IPR002433	144	166	PR01182	Ornithine decarboxylase
	IPR000183	194	207	PR01179	Orn/DAP/Arg decarboxylase 2
	IPR000183	277	296	PR01179	Orn/DAP/Arg decarboxylase 2
	IPR002433	326	339	PR01182	Ornithine decarboxylase
	IPR002433	360	370	PR01182	Ornithine decarboxylase
	IPR002433	380	393	PR01182	Ornithine decarboxylase
	IPR000183	393	406	PR01179	Orn/DAP/Arg decarboxylase 2
HMMPfam	IPR000183	50	288	PF02784	Orn/DAP/Arg decarboxylase 2
HMMPfam	IPR000183	291	414	PF00278	Orn/DAP/Arg decarboxylase 2
ScanRegExp	IPR000183	72	90	PS00878	Orn/DAP/Arg decarboxylase 2
ScanRegExp	IPR000183	228	245	PS00879	Orn/DAP/Arg decarboxylase 2

Primer_f	ACCTCCAAGACCATCGTGTAC
Primer_r	ACGCAATCACAGCCATCAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-