Gene/Protein Characteristic Table for KIAA1897
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06541
Accession No AB067484
Description pseudouridylate synthase 7 (putative)
Clone name fk06538
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3220 bp)
Predicted protein sequence (645 aa)
Source Human fetal brain
Rouge ID mKIAA1897 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3220 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1281 bp
Genome contig ID gi89161213r_104784192
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GTTATGTAAATAAATCAAATAAATATATCAAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGCAGATAAGAATCTTGACCTTGACTAAAGGTAAGGAACTAAATGAAT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 7 r 104884192 104936130 15 99.6 Perfect prediction
Features of the protein sequence
Description

Length: 645 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001089515 0 98.6 pseudouridylate...
Macaca mulatta
XP_527856 0 98.9 pseudouridylate...
Pan troglodytes
Q96PZ0 0 98.9 Pseudouridylate...
Homo sapiens
BAG54704 0 98.8 unnamed protein...
Homo sapiens
BAG52324 0 98.6 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001656 206 631 PF01142 tRNA pseudouridine synthase D
HMMTigr IPR001656 238 632 TIGR00094 tRNA pseudouridine synthase D
ProfileScan IPR011760 354 564 PS50984 TRUD
ScanRegExp IPR001656 275 288 PS01268 tRNA pseudouridine synthase D
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AAGAAGCCTACAGGGAAATGC
Primer_r TGCAACGACTTCCCAGCTAAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp