Gene/Protein Characteristic Table for KIAA1894
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04656
Accession No AB067481
Description CUB and Sushi multiple domains 3
Clone name ff08107
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (10774 bp)
Predicted protein sequence (2977 aa)
Source Human fetal brain
Rouge ID mKIAA1894 by Kazusa Mouse cDNA Project
Note We replaced fk04407, former representative clones for KIAA1894 with ff08107. (2003/8/28)
Features of the cloned cDNA sequence
Description

Length: 10774 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1840 bp
Genome contig ID gi51511724r_113204337
PolyA signal sequence
(AATAAA,-25)		 
+----*----+----*----+----*----+----
ATGTAAACAAAATAAAAATGGATAATTGCTTTTGT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAATGTGTTTTTTTTTCCAAAAATAAACTGCAACTGTTCAGGTTAGTAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 8 r 113304337 113771447 56 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 2977 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAO34702 0 95.5 CUB and sushi m...
 Homo sapiens
NP_443132 0 95.5 CUB and Sushi m...
 Homo sapiens
EAW91946 0 95.5 CUB and Sushi m...
 Homo sapiens
EAW91945 0 95.5 CUB and Sushi m...
 Homo sapiens
XP_001063165 0 93.4 similar to CUB ...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB067477 6.4e-196 64.2 KIAA1890
AB067471 4.8e-184 48.4 KIAA1884
AB023144 5e-45 30.9 KIAA0927
AB023149 7.1e-10 27.9 KIAA0932
AB011539 7.9e-06 22.2 KIAA0815
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000436 4 57 PF00084 Sushi/SCR/CCP
IPR000859 61 166 PF00431 CUB
IPR000436 174 231 PF00084 Sushi/SCR/CCP
IPR000859 235 340 PF00431 CUB
IPR000436 350 403 PF00084 Sushi/SCR/CCP
IPR000859 407 514 PF00431 CUB
IPR000436 522 577 PF00084 Sushi/SCR/CCP
IPR000859 581 686 PF00431 CUB
IPR000436 694 750 PF00084 Sushi/SCR/CCP
IPR000859 754 860 PF00431 CUB
IPR000436 868 924 PF00084 Sushi/SCR/CCP
IPR000859 928 1033 PF00431 CUB
IPR000436 1041 1098 PF00084 Sushi/SCR/CCP
IPR000859 1102 1140 PF00431 CUB
IPR000436 1148 1205 PF00084 Sushi/SCR/CCP
IPR000859 1209 1314 PF00431 CUB
IPR000436 1322 1377 PF00084 Sushi/SCR/CCP
IPR000859 1381 1486 PF00431 CUB
IPR000436 1494 1549 PF00084 Sushi/SCR/CCP
IPR000859 1553 1657 PF00431 CUB
IPR000436 1665 1722 PF00084 Sushi/SCR/CCP
IPR000859 1734 1834 PF00431 CUB
IPR000436 1839 1897 PF00084 Sushi/SCR/CCP
IPR000436 1902 1959 PF00084 Sushi/SCR/CCP
IPR000436 1964 2024 PF00084 Sushi/SCR/CCP
IPR000436 2029 2082 PF00084 Sushi/SCR/CCP
IPR000436 2087 2140 PF00084 Sushi/SCR/CCP
IPR000436 2145 2198 PF00084 Sushi/SCR/CCP
IPR000436 2203 2260 PF00084 Sushi/SCR/CCP
IPR000436 2265 2318 PF00084 Sushi/SCR/CCP
IPR000436 2326 2379 PF00084 Sushi/SCR/CCP
IPR000436 2384 2438 PF00084 Sushi/SCR/CCP
IPR000436 2443 2498 PF00084 Sushi/SCR/CCP
IPR000436 2503 2556 PF00084 Sushi/SCR/CCP
IPR000436 2561 2614 PF00084 Sushi/SCR/CCP
IPR000436 2622 2676 PF00084 Sushi/SCR/CCP
IPR000436 2681 2736 PF00084 Sushi/SCR/CCP
HMMSmart IPR000436 4 57 SM00032 Sushi/SCR/CCP
IPR000859 61 169 SM00042 CUB
IPR000436 174 231 SM00032 Sushi/SCR/CCP
IPR000859 235 343 SM00042 CUB
IPR000436 350 403 SM00032 Sushi/SCR/CCP
IPR000859 407 517 SM00042 CUB
IPR000436 522 577 SM00032 Sushi/SCR/CCP
IPR000859 581 689 SM00042 CUB
IPR000436 694 750 SM00032 Sushi/SCR/CCP
IPR000859 754 863 SM00042 CUB
IPR000436 868 924 SM00032 Sushi/SCR/CCP
IPR000859 928 1036 SM00042 CUB
IPR000436 1041 1098 SM00032 Sushi/SCR/CCP
IPR000436 1148 1205 SM00032 Sushi/SCR/CCP
IPR000859 1209 1317 SM00042 CUB
IPR000436 1322 1377 SM00032 Sushi/SCR/CCP
IPR000859 1381 1489 SM00042 CUB
IPR000436 1494 1549 SM00032 Sushi/SCR/CCP
IPR000859 1553 1660 SM00042 CUB
IPR000436 1665 1722 SM00032 Sushi/SCR/CCP
IPR000859 1727 1837 SM00042 CUB
IPR000436 1839 1897 SM00032 Sushi/SCR/CCP
IPR000436 1902 1959 SM00032 Sushi/SCR/CCP
IPR000436 1964 2024 SM00032 Sushi/SCR/CCP
IPR000436 2029 2082 SM00032 Sushi/SCR/CCP
IPR000436 2087 2140 SM00032 Sushi/SCR/CCP
IPR000436 2145 2198 SM00032 Sushi/SCR/CCP
IPR000436 2203 2260 SM00032 Sushi/SCR/CCP
IPR000436 2265 2318 SM00032 Sushi/SCR/CCP
IPR000436 2326 2379 SM00032 Sushi/SCR/CCP
IPR000436 2384 2438 SM00032 Sushi/SCR/CCP
IPR000436 2443 2498 SM00032 Sushi/SCR/CCP
IPR000436 2503 2556 SM00032 Sushi/SCR/CCP
IPR000436 2561 2614 SM00032 Sushi/SCR/CCP
IPR000436 2622 2676 SM00032 Sushi/SCR/CCP
IPR000436 2681 2736 SM00032 Sushi/SCR/CCP
ProfileScan IPR000436 2 59 PS50923 Sushi/SCR/CCP
IPR000859 61 169 PS01180 CUB
IPR000436 172 233 PS50923 Sushi/SCR/CCP
IPR000859 235 343 PS01180 CUB
IPR000436 348 405 PS50923 Sushi/SCR/CCP
IPR000859 407 517 PS01180 CUB
IPR000436 520 579 PS50923 Sushi/SCR/CCP
IPR000859 581 689 PS01180 CUB
IPR000436 692 752 PS50923 Sushi/SCR/CCP
IPR000859 754 863 PS01180 CUB
IPR000436 866 926 PS50923 Sushi/SCR/CCP
IPR000859 928 1036 PS01180 CUB
IPR000436 1039 1100 PS50923 Sushi/SCR/CCP
IPR000859 1102 1135 PS01180 CUB
IPR000436 1146 1207 PS50923 Sushi/SCR/CCP
IPR000859 1209 1317 PS01180 CUB
IPR000436 1320 1379 PS50923 Sushi/SCR/CCP
IPR000859 1381 1489 PS01180 CUB
IPR000436 1492 1551 PS50923 Sushi/SCR/CCP
IPR000859 1553 1664 PS01180 CUB
IPR000436 1663 1724 PS50923 Sushi/SCR/CCP
IPR000859 1726 1837 PS01180 CUB
IPR000436 1837 1899 PS50923 Sushi/SCR/CCP
IPR000436 1900 1961 PS50923 Sushi/SCR/CCP
IPR000436 1962 2026 PS50923 Sushi/SCR/CCP
IPR000436 2027 2084 PS50923 Sushi/SCR/CCP
IPR000436 2085 2142 PS50923 Sushi/SCR/CCP
IPR000436 2143 2200 PS50923 Sushi/SCR/CCP
IPR000436 2201 2262 PS50923 Sushi/SCR/CCP
IPR000436 2263 2320 PS50923 Sushi/SCR/CCP
IPR000436 2324 2381 PS50923 Sushi/SCR/CCP
IPR000436 2382 2440 PS50923 Sushi/SCR/CCP
IPR000436 2441 2500 PS50923 Sushi/SCR/CCP
IPR000436 2501 2558 PS50923 Sushi/SCR/CCP
IPR000436 2559 2616 PS50923 Sushi/SCR/CCP
IPR000436 2620 2678 PS50923 Sushi/SCR/CCP
IPR000436 2679 2738 PS50923 Sushi/SCR/CCP
ScanRegExp IPR001000 509 519 PS00591 Glycoside hydrolase

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 2900 SVAIAILVPFFALIFAGFGF 2919 PRIMARY 20
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATTATTCAGTGAGCTATGGGG
Primer_r GGATGGTAAGTTTGGTGTCTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 8
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp