Order Kazusa clone(s) from : ![]() |
Product ID | ORK04525 |
---|---|
Accession No | AB051527 |
Description | cat eye syndrome chromosome region, candidate 2 |
Clone name | pj00674 |
Vector information | |
cDNA sequence | DNA sequence (3837 bp) Predicted protein sequence (1119 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1740
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 475 bp |
---|---|
Genome contig ID | gi89161203f_16283223 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (129794 - 129843) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 22 | f | 16383223 | 16413015 | 11 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001487 | 89 | 102 | PR00503 | Bromodomain |
IPR001487 | 103 | 119 | PR00503 | Bromodomain | |
IPR001487 | 119 | 137 | PR00503 | Bromodomain | |
IPR001487 | 137 | 156 | PR00503 | Bromodomain | |
HMMPfam | IPR001487 | 75 | 161 | PF00439 | Bromodomain |
HMMSmart | IPR001487 | 71 | 175 | SM00297 | Bromodomain |
ProfileScan | IPR001487 | 86 | 156 | PS50014 | Bromodomain |
ScanRegExp | IPR001487 | 91 | 148 | PS00633 | Bromodomain |
![]() |
Primer_f | TTAACTTCTCCAACCCGTATG |
---|---|
Primer_r | AGATACTCGCTGGCTGACAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |