KIAA1740

Product ID	ORK04525
Accession No	AB051527
Description	cat eye syndrome chromosome region, candidate 2
Clone name	pj00674
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3837 bp) Predicted protein sequence (1119 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1740 by Kazusa Mouse cDNA Project

Length: 3837 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	475 bp
Genome contig ID	gi89161203f_16283223
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAGTTTACAGAATTTTCATGTTGCCTTTTAAAAT
Flanking genome sequence (129794 - 129843)	----+--------+--------+--------+--------+----* AATTTTTGTTGGTGGTGAATGTATTGTACATAAAGTGGGAAGGGTGGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	16383223	16413015	11	100.0	Perfect prediction

Length: 1119 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH56212	99.7	hypothetical pr...	Homo sapiens
EAW57756	99.9	hCG21538, isofo...	Homo sapiens
EAW57755	97.9	hCG21538, isofo...	Homo sapiens
Q9BXF3	98.2	Cat eye syndrom...	Homo sapiens
EAW57757	99.8	hCG21538, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	89	102	PR00503	Bromodomain
	IPR001487	103	119	PR00503	Bromodomain
	IPR001487	119	137	PR00503	Bromodomain
	IPR001487	137	156	PR00503	Bromodomain
HMMPfam	IPR001487	75	161	PF00439	Bromodomain
HMMSmart	IPR001487	71	175	SM00297	Bromodomain
ProfileScan	IPR001487	86	156	PS50014	Bromodomain
ScanRegExp	IPR001487	91	148	PS00633	Bromodomain

Primer_f	TTAACTTCTCCAACCCGTATG
Primer_r	AGATACTCGCTGGCTGACAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-