Order Kazusa clone(s) from : ![]() |
Product ID | ORK05475 |
---|---|
Accession No | AB046798 |
Description | HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase |
Clone name | fj04270 |
Vector information | |
cDNA sequence | DNA sequence (3670 bp) Predicted protein sequence (1202 aa) |
Source | Human fetal brain |
Note | Please refer to "Gene/Protein Characteristic Table for KIAA0312" because the cDNA sequence of KIAA1578 is included in KIAA0312. |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000449 | 72 | 110 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR004170 | 364 | 435 | PF02825 | WWE | |
HMMSmart | IPR000449 | 73 | 109 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B |
ProfileScan | IPR000449 | 71 | 110 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR004170 | 358 | 435 | PS50918 | WWE |
![]() |
Primer_f | AACATCATTCGGCTTTTCCTG |
---|---|
Primer_r | TACTGGGCTGGTTCACAATCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | CAGAGCAGTGACTTTGATACG |
Primer_r | GAGGTAGGCATTAAAGGTTTG |
PCR product length | 218(1.6k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |