Order Kazusa clone(s) from : ![]() |
Product ID | ORK00856 |
---|---|
Accession No | AB040952 |
Description | centrosomal protein 72kDa |
Clone name | fh13905s1 |
Vector information | |
cDNA sequence | DNA sequence (2352 bp) Predicted protein sequence (648 aa) |
HaloTag ORF Clone |
FHC00856
![]() |
Flexi ORF Clone | FXC00856 |
Source | Human fetal brain |
Rouge ID |
mKIAA1519
by Kazusa Mouse cDNA Project
|
Note | We replaced fh13905, former representative clones for KIAA1519 with fh13905s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 398 bp |
---|---|
Genome contig ID | gi51511721f_565467 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (141199 - 141248) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 665467 | 706664 | 12 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 57 | 70 | PR00019 | Leucine-rich repeat |
IPR001611 | 76 | 89 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 56 | 76 | PF00560 | Leucine-rich repeat |
IPR001611 | 78 | 98 | PF00560 | Leucine-rich repeat | |
HMMSmart | IPR003591 | 54 | 75 | SM00369 | Leucine-rich repeat |
IPR003591 | 76 | 98 | SM00369 | Leucine-rich repeat | |
IPR003603 | 118 | 136 | SM00446 | U2A'/phosphoprotein 32 family A |
![]() |
Primer_f | TACCAAGAGAAGATCACCCAC |
---|---|
Primer_r | AACACTTCTGCCAACGAGGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |