Order Kazusa clone(s) from : ![]() |
Product ID | ORK06577 |
---|---|
Accession No | AB040911 |
Description | Rac GTPase activating protein 1 |
Clone name | fj05212 |
Vector information | |
cDNA sequence | DNA sequence (2818 bp) Predicted protein sequence (570 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1478
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1104 bp |
---|---|
Genome contig ID | gi89161190r_48569214 |
PolyA signal sequence (AGTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 48669214 | 48686586 | 15 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002219 | 225 | 276 | PF00130 | Protein kinase C |
IPR000198 | 301 | 451 | PF00620 | RhoGAP | |
HMMSmart | IPR002219 | 225 | 273 | SM00109 | Protein kinase C |
IPR000198 | 298 | 474 | SM00324 | RhoGAP | |
ProfileScan | IPR002219 | 224 | 273 | PS50081 | Protein kinase C |
IPR000198 | 287 | 477 | PS50238 | RhoGAP | |
ScanRegExp | IPR002219 | 225 | 273 | PS00479 | Protein kinase C |
![]() |
Primer_f | AGGCTATAAGGGAAGATTGTC |
---|---|
Primer_r | GATAAGGGTCAATACGAAGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |