KIAA1478

Product ID	ORK06577
Accession No	AB040911
Description	Rac GTPase activating protein 1
Clone name	fj05212
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2818 bp) Predicted protein sequence (570 aa)
Source	Human fetal brain
Rouge ID	mKIAA1478 by Kazusa Mouse cDNA Project

Length: 2818 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1104 bp
Genome contig ID	gi89161190r_48569214
PolyA signal sequence (AGTAAA,-22)	+--------+--------+----*----+---- TATTTGGAAAAAAAGTAAATAGCTTTTTCAAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATGAGGCTGGTTTTCTTGTCTTGCAAGGTAATTTTCAATGCCTTTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	48669214	48686586	15	99.6	Perfect prediction

Length: 570 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H0H5	100.0	Rac GTPase-acti...	Homo sapiens
BAA90247	99.8	GTPase activati...	Homo sapiens
XP_001156282	99.5	hypothetical pr...	Pan troglodytes
XP_001156917	99.5	hypothetical pr...	Pan troglodytes
BAG38131	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014521	2.6e-13	31.0	KIAA0621
AB037845	2.6e-12	27.1	KIAA1424
AB040934	8e-12	27.2	KIAA1501
AB014572	1.1e-09	29.0	KIAA0672
AB033030	1.3e-09	26.6	KIAA1204

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	225	276	PF00130	Protein kinase C
HMMPfam	IPR000198	301	451	PF00620	RhoGAP
HMMSmart	IPR002219	225	273	SM00109	Protein kinase C
HMMSmart	IPR000198	298	474	SM00324	RhoGAP
ProfileScan	IPR002219	224	273	PS50081	Protein kinase C
ProfileScan	IPR000198	287	477	PS50238	RhoGAP
ScanRegExp	IPR002219	225	273	PS00479	Protein kinase C

Primer_f	AGGCTATAAGGGAAGATTGTC
Primer_r	GATAAGGGTCAATACGAAGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-