KIAA1204

Product ID	ORK00200
Accession No	AB033030
Description	Rho GTPase activating protein 31
Clone name	fg03451
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6321 bp) Predicted protein sequence (1445 aa)
HaloTag ORF Clone	FHC00200
Flexi ORF Clone	FXC00200
Source	Human fetal brain
Rouge ID	mKIAA1204 by Kazusa Mouse cDNA Project

Length: 6321 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1454 bp
Genome contig ID	gi89161205f_120395919
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAGCAGAAGCAATAAACCAATCTGATTTTCTTTTC
Flanking genome sequence (223337 - 223386)	----+--------+--------+--------+--------+----* AATTATTTATAACTTTCAATGGTTCTTTCCTTTCCAGCTGGCGAGAGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	120495910	120619254	12	99.3	Perfect prediction

Length: 1445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q2M1Z3	100.0	Cdc42 GTPase-ac...	Homo sapiens
EAW79573	99.9	Cdc42 GTPase-ac...	Homo sapiens
XP_001162142	98.8	Cdc42 GTPase-ac...	Pan troglodytes
XP_593520	83.7	similar to Cdc4...	Bos taurus
XP_856487	82.7	similar to Cdc4...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018255	5.4e-24	28.8	KIAA0712
AB040934	7.2e-05	31.1	KIAA1501
AB014572	0.00021	24.7	KIAA0672
AB037845	0.00044	21.6	KIAA1424
AB014521	0.00086	26.9	KIAA0621

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000198	36	188	PF00620	RhoGAP
HMMSmart	IPR000198	33	214	SM00324	RhoGAP
ProfileScan	IPR000198	22	217	PS50238	RhoGAP

Primer_f	CATACAAAGGCAGAACTACAC
Primer_r	CAGTGAGTGGTTGTGATGGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-