KIAA1468

Product ID	ORK05664
Accession No	AB040901
Description	KIAA1468
Clone name	fj01719
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4661 bp) Predicted protein sequence (985 aa)
Source	Human fetal brain
Rouge ID	mKIAA1468 by Kazusa Mouse cDNA Project

Length: 4661 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1578 bp
Genome contig ID	gi51511735f_57939646
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AATGTTGATCTATTATAAATAAAATGTTTTTGCAT
Flanking genome sequence (185681 - 185730)	----+--------+--------+--------+--------+----* ATGTTTTTGATTTGGTTTGGGCTATGCATTTTACTTTCGTTTTGAAACAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	58039644	58125325	26	99.6	Terminal No-hit

Length: 985 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001144763	99.8	hypothetical pr...	Pan troglodytes
XP_512162	96.3	hypothetical pr...	Pan troglodytes
XP_001144840	95.2	hypothetical pr...	Pan troglodytes
CAH90558	96.1	hypothetical pr...	Pongo abelii
XP_001089393	94.6	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	330	366	PF02985	HEAT
	IPR000357	369	406	PF02985	HEAT
	IPR000357	767	803	PF02985	HEAT
ProfileScan	IPR000357	773	811	PS50077	HEAT

Primer_f	CCTCGTCCCTTAAAGTCAGTG
Primer_r	CATTAACCCCTCAAACCAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-