KIAA1399

Product ID	ORK00826
Accession No	AB037820
Description	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Clone name	hk07377
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4450 bp) Predicted protein sequence (452 aa)
HaloTag ORF Clone	FHC00826
Flexi ORF Clone	FXC00826
Source	Human adult brain
Rouge ID	mKIAA1399 by Kazusa Mouse cDNA Project

Length: 4450 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1450 bp
Genome contig ID	gi89161199r_216730834
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTTAAAAGCTTGAAAATAAAACTTCTTTCCCTACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTAGTGTCCCTTTCCATATGCGAGTTTTTCTTCCTCTTCCCTATCCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	216830834	216944995	4	99.6	Perfect prediction

Length: 452 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9P2E8	8.2e-149	100.0	E3 ubiquitin-pr...	Homo sapiens
XP_526023	3.5e-148	99.8	membrane-associ...	Pan troglodytes
XP_545636	1.1e-140	87.6	similar to memb...	Canis lupus fam...
XP_001490009	1.9e-136	92.7	membrane-associ...	Equus caballus
XP_001789546	1e-135	92.2	similar to memb...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	205	250	PF00097	Zinc finger
HMMSmart	IPR011016	204	251	SM00744	Zinc finger

Primer_f	TGGCTCATCTGGTCAACTTTC
Primer_r	TGTCTTGTCATAGTTCAGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-