Order Kazusa clone(s) from : ![]() |
Product ID | ORK06396 |
---|---|
Accession No | AB033035 |
Description | pleckstrin homology domain containing, family G (with RhoGef domain) member 1 |
Clone name | fg05970 |
Vector information | |
cDNA sequence | DNA sequence (6110 bp) Predicted protein sequence (1113 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1209
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2767 bp |
---|---|
Genome contig ID | gi89161210f_151067474 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (139020 - 139069) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 151167474 | 151206492 | 10 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTATCACAGGTCCCAGTCATC |
---|---|
Primer_r | TTCTGTGAGTCTTGGAGTGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |