Order Kazusa clone(s) from : ![]() |
Product ID | ORK00760 |
---|---|
Accession No | AB033020 |
Description | CCR4-NOT transcription complex, subunit 6 |
Clone name | fg00908 |
Vector information | |
cDNA sequence | DNA sequence (6255 bp) Predicted protein sequence (575 aa) |
HaloTag ORF Clone |
FHC00760
![]() |
Flexi ORF Clone | FXC00760 |
Source | Human fetal brain |
Rouge ID |
mKIAA1194
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4157 bp |
---|---|
Genome contig ID | gi51511721f_179754180 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (183777 - 183826) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 179854039 | 179937955 | 14 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 71 | 84 | PR00019 | Leucine-rich repeat |
IPR001611 | 91 | 104 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 70 | 91 | PF00560 | Leucine-rich repeat |
IPR001611 | 93 | 114 | PF00560 | Leucine-rich repeat | |
IPR001611 | 116 | 137 | PF00560 | Leucine-rich repeat | |
IPR005135 | 207 | 556 | PF03372 | Endonuclease/exonuclease/phosphatase | |
HMMSmart | IPR003591 | 68 | 90 | SM00369 | Leucine-rich repeat |
IPR003591 | 91 | 113 | SM00369 | Leucine-rich repeat | |
IPR003591 | 114 | 137 | SM00369 | Leucine-rich repeat |
![]() |
Primer_f | ACTGTGTTGGTAATGTGCATC |
---|---|
Primer_r | ATAAAGCTCTCTGGACCTGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |