KIAA1186

Product ID	ORK00757
Accession No	AB033012
Description	SEC14-like lipid binding 2, transcript variant 1
Clone name	pj00504
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4168 bp) Predicted protein sequence (405 aa)
HaloTag ORF Clone	FHC00757
Flexi ORF Clone	FXC00757
Source	Human brain (hippocampus)
Rouge ID	mKIAA1186 by Kazusa Mouse cDNA Project
Note	We replaced hg02441a, former representative clones for KIAA1186 with pj00504. (1999/11/11)

Length: 4168 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2881 bp
Genome contig ID	gi89161203f_29023031
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- GAACATGTAGACTGGCAATAAACTCAATAAATGGT
Flanking genome sequence (128247 - 128296)	----+--------+--------+--------+--------+----* GACTGTTATAATTAATCCTCGGAACCATCCTAGGGAGTGGACACTATTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	29123031	29151276	12	99.3	Perfect prediction

Length: 405 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O76054	5.1e-182	100.0	SEC14-like prot...	Homo sapiens
BAD97307	9.7e-182	99.8	SEC14-like 2 va...	Homo sapiens
BAG37015	1.1e-181	99.5	unnamed protein...	Homo sapiens
1OLM	1.3e-181	99.8	SUPERNATANT PRO...	Homo sapiens
XP_515071	2.2e-181	99.3	SEC14-like 2 is...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007880	7.2e-39	33.9	KIAA0420

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001071	39	61	PR00180	Cellular retinaldehyde binding/alpha-tocopherol transport
	IPR001071	204	223	PR00180	Cellular retinaldehyde binding/alpha-tocopherol transport
	IPR001071	237	246	PR00180	Cellular retinaldehyde binding/alpha-tocopherol transport
HMMPfam	IPR008273	5	73	PF03765	Cellular retinaldehyde-binding/triple function
	IPR001251	87	246	PF00650	Cellular retinaldehyde-binding/triple function
	IPR000348	299	385	PF01105	emp24/gp25L/p24
HMMSmart	IPR001251	78	248	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR001251	78	251	PS50191	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR009038	277	385	PS50866	GOLD