KIAA1177

Product ID	ORK07375
Accession No	AB033003
Description	XPA binding protein 2
Clone name	hf00837a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2330 bp) Predicted protein sequence (755 aa)
Source	Human adult brain
Rouge ID	mKIAA1177 by Kazusa Mouse cDNA Project

Length: 2330 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	60 bp
Genome contig ID	gi42406306r_7490472
PolyA signal sequence (AATACA,-22)	+--------+--------+----*----+---- CCACCCCCTCCCCAATACAGCTACGTTTGTACATC
Flanking genome sequence (99940 - 99891)	----+--------+--------+--------+--------+----* ATGGTCTGAGCCTCCTTCCTGCTGCCCAGGTGCCCGAGGGAGTACAGCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	7590412	7598639	17	100.0	Perfect prediction

Length: 755 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCS7	100.0	Pre-mRNA-splici...	Homo sapiens
BAB15807	99.9	XAB2 [Homo sapi...	Homo sapiens
AAQ14304	99.9	crn-related pro...	Homo sapiens
Q99PK0	99.1	Pre-mRNA-splici...	Rattus norvegicus
Q9DCD2	99.1	Pre-mRNA-splici...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013105	156	189	PF07719	Tetratricopeptide TPR_2
HMMSmart	IPR003107	24	58	SM00386	RNA-processing protein
	IPR013026	156	189	SM00028	Tetratricopeptide region
	IPR003107	170	205	SM00386	RNA-processing protein
	IPR013026	295	328	SM00028	Tetratricopeptide region
	IPR003107	309	345	SM00386	RNA-processing protein
	IPR013026	333	366	SM00028	Tetratricopeptide region
	IPR003107	347	396	SM00386	RNA-processing protein
	IPR003107	398	430	SM00386	RNA-processing protein
	IPR003107	432	466	SM00386	RNA-processing protein
	IPR003107	471	505	SM00386	RNA-processing protein
	IPR003107	507	541	SM00386	RNA-processing protein
	IPR003107	579	613	SM00386	RNA-processing protein
ProfileScan	IPR013026	10	43	PS50005	Tetratricopeptide region
	IPR013026	156	189	PS50005	Tetratricopeptide region
	IPR013026	156	189	PS50293	Tetratricopeptide region
	IPR013026	295	328	PS50005	Tetratricopeptide region
	IPR013026	295	366	PS50293	Tetratricopeptide region
	IPR013026	333	366	PS50005	Tetratricopeptide region
	IPR013026	384	451	PS50293	Tetratricopeptide region

Primer_f	GAGCAAGATCCTGTTCGTGAG
Primer_r	GTCAGTCTTCCTTCAGGCTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAGCAAGATCCTGTTCGTGAG
Primer_r	GTCAGTCTTCCTTCAGGCTCC
PCR product length	194 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles