Order Kazusa clone(s) from : ![]() |
Product ID | ORK04253 |
---|---|
Accession No | AB029019 |
Description | proline-rich coiled-coil 2C |
Clone name | pf00402 |
Vector information | |
cDNA sequence | DNA sequence (7421 bp) Predicted protein sequence (1919 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1096
by Kazusa Mouse cDNA Project
|
Note | We replaced hk06861, former representative clones for KIAA1096 with pf00402. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 1659 bp |
---|---|
Genome contig ID | gi89161185f_169676024 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (153246 - 153295) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 169776024 | 169829268 | 21 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TGTGTTGAGTTGGCATTGTAC |
---|---|
Primer_r | CAAACCCATGTAGATAAGACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |