KIAA1058

Product ID	ORK00726
Accession No	AB028981
Description	dedicator of cytokinesis 9, transcript variant 2
Clone name	hh12146s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a cDNA fragment (1-1846) was subcloned upstream of the cDNA (1847-7545). The adjacent sequence to the 5' end of the cDNA is as follows: CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA.
cDNA sequence	DNA sequence (7545 bp) Predicted protein sequence (2095 aa)
HaloTag ORF Clone	FHC00726
Flexi ORF Clone	FXC00726
Source	Human adult brain
Rouge ID	mKIAA1058 by Kazusa Mouse cDNA Project
Note	We replaced hh12146, former representative clones for KIAA1058 with hh12146s1. (2002/5/10)

Length: 7545 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1257 bp
Genome contig ID	gi51511729r_98143745
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TGTACCACATCTGTATTAAAAAGACATTGCTGACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGGGGTGGCTGCTGGGTGTTTATTGTTCAGCAGTCCTAAGGGAACAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	98243745	98428245	55	99.6	Perfect prediction

Length: 2095 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001090732	99.7	dedicator of cy...	Macaca mulatta
CAI13370	100.0	novel protein [...	Homo sapiens
Q9BZ29	100.0	Dedicator of cy...	Homo sapiens
XP_001145143	99.9	dedicator of cy...	Pan troglodytes
XP_509710	99.8	dedicator of cy...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037816	1.5e-35	30.7	KIAA1395
AB051558	5.3e-35	31.7	KIAA1771
AB014594	2.8e-25	47.2	KIAA0694

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	201	307	PF00169	Pleckstrin-like
HMMPfam	IPR010703	1911	2090	PF06920	Dedicator of cytokinesis
HMMSmart	IPR001849	201	309	SM00233	Pleckstrin-like
ProfileScan	IPR001849	200	307	PS50003	Pleckstrin-like

Primer_f	ATGCGCGAGCTTTCTTAGATG
Primer_r	TTCTTCCTGATACTCGAGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-