KIAA0998

Product ID	ORK07245
Accession No	AB023215
Description	tubulin tyrosine ligase-like family member 5
Clone name	hk08691
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4313 bp) Predicted protein sequence (1226 aa)
Source	Human adult brain
Rouge ID	mKIAA0998 by Kazusa Mouse cDNA Project

Length: 4313 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	632 bp
Genome contig ID	gi51511730f_75117639
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTGATTTCAAAGATTAATAAAGTAATTCTATTTTT
Flanking genome sequence (373537 - 373586)	----+--------+--------+--------+--------+----* ATTTTCTTTTTTTTCCCTTTACTAATTTCCCAACAATCAATATTCACAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	75205603	75491174	30	99.9	Perfect prediction

Length: 1226 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAP75557	100.0	SRC1 and TIF2 a...	Homo sapiens
EAW81247	99.9	hCG2028821, iso...	Homo sapiens
Q6EMB2	99.8	Tubulin polyglu...	Homo sapiens
NP_055887	99.8	tubulin tyrosin...	Homo sapiens
EAW81244	99.9	hCG2028821, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79995	8.6e-32	38.0	KIAA0173

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004344	56	351	PF03133	Tubulin-tyrosine ligase
ProfileScan	IPR004344	7	352	PS51221	Tubulin-tyrosine ligase

Primer_f	GAGCATTCATCACAAGTTTCC
Primer_r	ATCAGTAATTCCAAAGGGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAGCATTCATCACAAGTTTCC
Primer_r	ATCAGTAATTCCAAAGGGTGC
PCR product length	94 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles