KIAA0923

Product ID	ORK00684
Accession No	AB023140
Description	synovial sarcoma, X breakpoint 2 interacting protein, transcript variant 5
Clone name	hh02882
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5835 bp) Predicted protein sequence (626 aa)
HaloTag ORF Clone	FHC00684
Flexi ORF Clone	FXC00684
Source	Human adult brain
Rouge ID	mKIAA0923 by Kazusa Mouse cDNA Project

Length: 5835 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3726 bp
Genome contig ID	gi89161185r_84781978
PolyA signal sequence (AATACA,-21)	+--------+--------+----*----+---- ATTTGTTGATGAGAAATACACTGATGAAACAACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTTTACTGGAATGAATGGACTATAAGTTTGGGGTTAGAATCCTAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	84881978	84928816	14	100.0	Perfect prediction

Length: 626 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001139479	1.4e-212	99.7	synovial sarcom...	Pan troglodytes
Q9Y2D8	2.1e-210	100.0	Afadin- and alp...	Homo sapiens
XP_001139549	1.2e-209	99.7	synovial sarcom...	Pan troglodytes
CAB61373	1.7e-209	99.8	hypothetical pr...	Homo sapiens
AAQ72373	1.7e-209	99.7	synovial sarcom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	AGCACCGTGAATCTAGTCTTG
Primer_r	AGTAATCACAGCAGGGTCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	AGCACCGTGAATCTAGTCTTG
Primer_r	AGTAATCACAGCAGGGTCTTG
PCR product length	125 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles