ROUGE |
Gene/Protein Characteristic Table for mKIAA0923 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173064 |
---|---|
synovial sarcoma, X breakpoint 2 interacting protein. afadin DIL domain-interacting protein. |
|
mph02954 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3424 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1305 bp Genome contig ID gi65492966f_145281207 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
TGCTGTGACTGTTGCATTAAATTCATCATGCTACCFlanking genome sequence
(135482 - 135531) ----+----*----+----*----+----*----+----*----+----*
AAAAGTGAAGCCTTGTGTTGTCCATTCACTGCGTGACTGTGGGTTCCGCA
KIAA Alignment based on: KIAA0923 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 236..2119
Length: 627 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |