Order Kazusa clone(s) from : ![]() |
Product ID | ORK00650 |
---|---|
Accession No | AB020640 |
Description | calmodulin binding transcription activator 1, transcript variant 1 |
Clone name | hg01719s1 |
Vector information | |
cDNA sequence | DNA sequence (6582 bp) Predicted protein sequence (1734 aa) |
HaloTag ORF Clone |
FHC00650
![]() |
Flexi ORF Clone | FXC00650 |
Source | Human adult brain |
Rouge ID |
mKIAA0833
by Kazusa Mouse cDNA Project
|
Note | We replaced hj04851 and hg01719, former representative clones for KIAA0833 with hg01719s1. (2001/5/29,2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1353 bp |
---|---|
Genome contig ID | gi89161185f_6667971 |
PolyA signal sequence (ACTAAA,-10) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (1082521 - 1082570) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 6767971 | 7750490 | 21 | 99.5 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005559 | 128 | 244 | PF03859 | CG-1 |
IPR002909 | 934 | 1013 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002110 | 1125 | 1147 | PF00023 | Ankyrin | |
IPR002110 | 1170 | 1190 | PF00023 | Ankyrin | |
IPR000048 | 1609 | 1629 | PF00612 | IQ calmodulin-binding region | |
IPR000048 | 1632 | 1652 | PF00612 | IQ calmodulin-binding region | |
ProfileScan | IPR002110 | 1125 | 1147 | PS50088 | Ankyrin |
IPR002110 | 1125 | 1224 | PS50297 | Ankyrin | |
IPR000048 | 1631 | 1657 | PS50096 | IQ calmodulin-binding region |
![]() |
Primer_f | GCGAGAAAAATGTGGATGTAC |
---|---|
Primer_r | CATTTTACAGACCATAGCCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCGAGAAAAATGTGGATGTAC |
Primer_r | CATTTTACAGACCATAGCCAC |
PCR product length | 123 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |