KIAA0887

Product ID	ORK00674
Accession No	AB020694
Description	Fas associated factor family member 2
Clone name	hk07788
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4456 bp) Predicted protein sequence (443 aa)
HaloTag ORF Clone	FHC00674
Flexi ORF Clone	FXC00674
Source	Human adult brain
Rouge ID	mKIAA0887 by Kazusa Mouse cDNA Project

Length: 4456 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3123 bp
Genome contig ID	gi51511721f_175708020
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- TAGGTTAACATTAAATGTTTTATAGCAAAAACTTC
Flanking genome sequence (161662 - 161711)	----+--------+--------+--------+--------+----* ATAACAGGCTGTGGATCTTTCTGTGTGGGACCGATGTGGTAGATAATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	175808020	175869680	11	99.3	Perfect prediction

Length: 443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96CS3	1.5e-156	100.0	FAS-associated ...	Homo sapiens
XP_546218	3.2e-156	99.8	similar to prot...	Canis lupus fam...
XP_518117	3.6e-156	99.8	UBX domain cont...	Pan troglodytes
XP_001090859	4.1e-156	99.8	similar to UBX ...	Macaca mulatta
XP_001502700	6.1e-156	99.3	UBX domain cont...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	10	51	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMPfam	IPR001012	354	439	PF00789	UBX
HMMSmart	IPR006577	136	261	SM00594	UAS
ProfileScan	IPR001012	355	437	PS50033	UBX

Primer_f	TGACTGAGAAGGAGCGATAAC
Primer_r	ATTTCCGTTGCTGTGTTCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGACTGAGAAGGAGCGATAAC
Primer_r	ATTTCCGTTGCTGTGTTCCTC
PCR product length	125 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles