KIAA0845

Product ID	ORK00655
Accession No	AB020652
Description	neurofilament, heavy polypeptide
Clone name	hk05234s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-598) was subcloned upstream of the cDNA (599-3929). The adjacent sequence to the 5' end of the cDNA is as follows: AATTGGGTAC CGGGCCCCCC-5' end of cDNA
cDNA sequence	DNA sequence (3929 bp) Predicted protein sequence (1034 aa)
HaloTag ORF Clone	FHC00655
Flexi ORF Clone	FXC00655
Source	Human adult brain
Rouge ID	mKIAA0845 by Kazusa Mouse cDNA Project
Note	We replaced hk05234, former representative clones for KIAA0845 with hk05234s1. (2002/12/27)

Length: 3929 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	583 bp
Genome contig ID	gi89161203f_28106243
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GCTTTTGTGCAATAAAACCAAGTGCTTATAAAATG
Flanking genome sequence (111034 - 111083)	----+--------+--------+--------+--------+----* AAAATGTTGCTGCTGTTATTCTCTTTCCCTGGGAAGGCTGGGGGCAGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	28196907	28217275	9	98.6	Internal No-hit

Length: 1034 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF13722	0	100.0	neurofilament p...	Homo sapiens
P12036	0	99.9	Neurofilament h...	Homo sapiens
BAG63896	0	100.0	unnamed protein...	Homo sapiens
EAW59805	0	99.4	neurofilament, ...	Homo sapiens
CAA33366	7.2e-217	99.3	heavy neurofila...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002351	0.00046	25.1	KIAA0353

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001664	104	420	PF00038	Intermediate filament protein
	IPR010790	549	579	PF07142	Protein of unknown function DUF1388
	IPR010790	583	613	PF07142	Protein of unknown function DUF1388
	IPR010790	618	647	PF07142	Protein of unknown function DUF1388
ScanRegExp	IPR001664	407	415	PS00226	Intermediate filament protein

Primer_f	TGAGATGTCTTAACCTATTCC
Primer_r	AAGCAATTGAAAGTGAACTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-