Order Kazusa clone(s) from : ![]() |
Product ID | ORK07289 |
---|---|
Accession No | AB018353 |
Description | Sad1 and UNC84 domain containing 1 |
Clone name | hk05647s1 |
Vector information | |
cDNA sequence | DNA sequence (4047 bp) Predicted protein sequence (824 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0810
by Kazusa Mouse cDNA Project
|
Note | We replaced hk05647, former representative clones for KIAA0810 with hk05647s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1571 bp |
---|---|
Genome contig ID | gi89161213f_738664 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (142403 - 142452) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 838657 | 881065 | 21 | 99.7 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 252 | WHIWACAGYFLLQILRRIGAVGQ | 274 | SECONDARY | 23 | 2 | 282 | SALWLAVVAPGKAASGVFWWLGI | 304 | PRIMARY | 23 | 3 | 317 | NVFLLTRCLRNICKFLVLLIPLF | 339 | PRIMARY | 23 |
---|
![]() |
Primer_f | GCAGCAGAAGCACTACCAAAG |
---|---|
Primer_r | ACTGATTTGGGATTTGGGGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCAGCAGAAGCACTACCAAAG |
Primer_r | ACTGATTTGGGATTTGGGGTG |
PCR product length | 130 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |