Order Kazusa clone(s) from : ![]() |
Product ID | ORK04821 |
---|---|
Accession No | AB018259 |
Description | dedicator of cytokinesis 4 |
Clone name | ah04178 |
Vector information | |
cDNA sequence | DNA sequence (6325 bp) Predicted protein sequence (1388 aa) |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA0716
by Kazusa Mouse cDNA Project
|
Note | We replaced hj03473, former representative clones for KIAA0716 with ah04178. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2156 bp |
---|---|
Genome contig ID | gi89161213r_111053410 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 111153410 | 111304420 | 36 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AATTTTGGCAGTGAGCAGTTG |
---|---|
Primer_r | ATTTACCATTCAGCAGCAACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AATTTTGGCAGTGAGCAGTTG |
Primer_r | ATTTACCATTCAGCAGCAACC |
PCR product length | 134 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |