KIAA0716

Product ID	ORK04821
Accession No	AB018259
Description	dedicator of cytokinesis 4
Clone name	ah04178
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6325 bp) Predicted protein sequence (1388 aa)
Source	Human brain (amygdala)
Rouge ID	mKIAA0716 by Kazusa Mouse cDNA Project
Note	We replaced hj03473, former representative clones for KIAA0716 with ah04178. (2005/08/06)

Length: 6325 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2156 bp
Genome contig ID	gi89161213r_111053410
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCTGAATGGTAAATATTAAATAAAATTACCAGATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCTTAATATTTCTGTCTTTACTCCTATCATCAGCATGTCTTTACTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	111153410	111304420	36	99.6	Perfect prediction

Length: 1388 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI41139	98.1	Dock4 protein [...	Mus musculus
P59764	95.4	Dedicator of cy...	Mus musculus
XP_539524	93.4	similar to Dedi...	Canis lupus fam...
XP_001167034	95.9	dedicator of cy...	Pan troglodytes
XP_001167212	94.7	dedicator of cy...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002297	1.2e-125	56.6	KIAA0299
D86964	3.3e-49	37.8	KIAA0209

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AATTTTGGCAGTGAGCAGTTG
Primer_r	ATTTACCATTCAGCAGCAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATTTTGGCAGTGAGCAGTTG
Primer_r	ATTTACCATTCAGCAGCAACC
PCR product length	134 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles