Order Kazusa clone(s) from : ![]() |
Product ID | ORK01964 |
---|---|
Accession No | D86964 |
Description | dedicator of cytokinesis 2 |
Clone name | ha04649 |
Vector information | |
cDNA sequence | DNA sequence (6050 bp) Predicted protein sequence (1842 aa) |
HaloTag ORF Clone |
FHC01964
![]() |
Flexi ORF Clone | FXC01964 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0209
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 519 bp |
---|---|
Genome contig ID | gi51511721f_168896871 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (546090 - 546139) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 168996871 | 169442959 | 52 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | AATCGGCTGAAGAAGGCAAAC |
Primer_r | TCTCTGTCTCCTCTAAGTAAG |
PCR product length | 189 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |